Chrysopidae (green lacewings) is a cosmopolitan family of Neuroptera, with over 1,200 species recognized in the world. Most chrysopid adults show green color and fine, complicated wing venation. The larvae of all species and the adults of some genera are predaceous and most feed on aphids, coccids and other soft-bodied insects. For this reason some species have been successfully used on the biological control of agricultural pests (New, 1975). However, identification of green lacewings is often very difficult because many species are superficially very similar (Brooks, 1983).

Studies on Korean neuropterans have been so scarce and most were studied by Japanese and east European scientists.

The family Chrysopidae of Korea had been reported to have one tribe, three genera, and 13 species (Paik, 1984). A decade later, based on an unpublished report (Rhee, 1993), the Korean Chrysopidae included two tribes, seven genera and 15 species, and this result was reflected to the Check List of Insects from Korea (ESK and KSAE, 1994).

The genus Italochrysa Principi include nearly 70 species in the world. Most species are distributed in tropical and subtropical regions, e.g., 30 species in tropical Africa, in which 19 of them were described or re-described by Tjeder (1966).

So far in Korea Italochrysa has been known with only one species, I. japonica (McLachlan). This species was first collected by Okamoto (1922) in Korea and rediscovered after over 60 years by Rhee (1993). In this study, we report another species, I. nigrovenosa Kuwayama in Korea. Italochrysa nigrovenosa was first reported from Japan (Kuwayama, 1970), and Kuwayama described the new species based on female characters of the species. We also collected female specimens only, and the identification based on its morphology was confirmed by comparing its COI barcode sequences with that of I. nigrovenosa from the BOLD site (www.boldsystems.org) and matching 99.74% in sequence similarity.

Here we provide brief descriptions of the genus and the species, with the female images of the adult and genitalia, the COI barcode sequence, and a key for the genus Italochrysa of Korea.

Materials and Methods

We used light traps and bucket traps for collecting. The specimens collected were saved either as a dry material or in 100% EtOH. For genital examination, a specimen was soaked in glycerol and examined through a stereo light microscope, often with an imaging facility. We also sequenced the barcoding region of the COI sequence of its mtDNA and compared with the COI barcoding sequences of the same species listed in the BOLD site. The specimens examined are deposited in the Insect Specimen room of the Department of Plant Medicine at the Chungbuk National University in Korea.

Systematic Account

Order Neuroptera Linnaeus, 1758 Family Chrysopidae Schneider, 1851 Genus ItalochrysaPrincipi, 1946 네모날개풀잠자리속 ItalochrysaPrincipi, 1946: 86; 1952: 13; Tjeder, 1966: 264; Kuwayama, 1970: 67; Hölzel, 1970: 51; Kis et al., 1970: 343; Hölzel, 1973: 378; Séméria, 1974: 254; New, 1980: 19; Aspöck et al., 1980: 237; Leraut, 1980: 242; Tsukaguchi, 1985: 503; Brooks and Barnard, 1990: 125, 157, 266.

Type-species: Hemerobius italicus Rossi, 1790.

Adult body size medium to very large. Antennae usually shorter than forewing, rarely longer in some species; labrum normally emarginate. Wings slightly narrow in width, with subacute apices; pterostigma unmarked, or rarely spotted at base; especially, intra-median cell 1 (im 1) subrectangular; forewing with 6 to 10 crossveins from Psm (pseudomedia) to Psc (pseudocubitus).

Italochrysa nigrovenosaKuwayama, 1970 몸노랑풀잠자리 (신칭) (Figs. 1, 2, 3a)

Diagnosis. Female. Body length 18-22 mm, forewing 25-30 mm, hindwing 22-26 mm (8n).

Head light yellow; palpi and vertex yellow; scape and pedicel yellow, flagella blackish with black hair; eyes dark blue. Thorax partially yellowish; both fore- and hind wings with veins consisting of yellow and black; costal veinlets blackish from 2 ^nd to 10 ^th ; im cell far beyond Rs-M cross vein; setae chiefly hyaline, not pigmented (Fig. 1). Abdomen testaceous, immaculate, sparsely clothed with whitish hair; 7 ^th sternite smoothly curved forward on hind margin; subgenitale with distinct, large ventral projection on apical lobe. Genitalia (male unavailable) 7 ^th sternite densely short-haired, rather hardened and concave at its ventral hind margin; 4 ^th tergite + ectoproct longer and not so abruptly expanded; lateral gonapophysis narrow with almost straight hind margin in lateral view (Fig. 2a); subgenitale in ventral view broad (Fig. 2b).

Material Examined

4 females: Weolag [Mt.], Mileug-li, Sangmo, Chungju, coll. S.K Kim, S.W Cho, Sep. 18, 2007; 2 females Weolag [Mt], Gwangcheon-li, Deogsan, Jechon, coll. S.K Kim, S.W Cho, Sep. 19, 2009; 1 female: Weolag [Mt.], Mileug-li, Sangmo, Chungju, coll. S.K Kim, S.W Cho, Aug. 10, 2007; 1 female: Sasong-ri, Baekgok-myeon, Jincheon-gun, coll. E.J Lim, Aug. 14, 2009; 2 females: Dung-eok-ri, Sangbuk-myeon, Ulju-gun, Ulsan-si, coll. S.K Kim, J.C Sohn, S.K Lee, Aug. 24, 2012; 1 female: Yong-ri, Yuga-myeon, Dalseong-gun, Daegu-si, coll. J.C Sohn, S.K Lee, Aug. 23, 2012.

Distribution

The species is widely distributed throughout the Ethiopian, Oriental and Australian regions, also occurring in the southern parts of the Palaearctic region.

Remarks

Italochrysa nigrovenosa is morphologically distinguishable from I. japonica as noted in the following key to the species. In addition, I. nigrovenosa has yellowish thorax and abdomen while I. japonica has bright pinkish spot on prothorax and light brownish stripes on meso- and metathorax and abdomen.

Key to the species of Italochrysa in Korea

1. Large species; body size 18-22 mm, body color yellowish, eyes dark blue, length of forewing 25-30 mm, and most proximal cross veinlets strongly blackish ························· ················· I. nigrovenosa 몸노랑풀잠자리(신칭) (Fig. 3a) 1'. Medium-sized species; body size 8-10 mm, body color reddish and yellowish, eyes reddish, length of forewing 18-20 mm, and cross veins mostly yellowish ··················· ······························· I. japonica 등빨간풀잠자리 (Fig. 3b)

COI barcode sequence

ANATACTTATTTTTGGCATTTGATCTGGATTAGTA GGTACAAGATTAAGTTTATTAATTCGAGCTGAATT AGGTCAACCTGGTTCTTTAATTGGAGATGATCAAA TTTATAATGTTATTGTTACAGCTCATGCCTTTATTA TGATTTTTTTCATAGTAATACCAATTATAATTGGA GGATTTGGTAATTGATTAGTTCCTTTAATATTAGC AGCTCCAGATATAGCTTTTCCACGAATAAATAATA TAAGATTTTGAATACTCCCACCATCATTAATTTTA CTACTATCCTCTTCAATAGTAGAAAGAGGTGCAG GAACTGGTTGAACAGTATACCCACCTTTATCTTCT AATATTGCTCATGCAGGAGCTTCTGTAGATTTAGC TATTTTTAGTTTACACTTAGCAGGAATTTCCTCAA TTCTAGGAGCTGTAAATTTTATTACTACAGTAATT AATATACGATTAAATTATATAACATTAGATCGTAT ACCTTTATTTGTTTGATCAGTAGTAATTACAGCTTT ATTATTATTATTATCATTACCTGTATTAGCAGGAG CTATTACTATATTATTAACAGATCGAAATTTAAAT ACCTCTTTTTTTGATCCTGCAGGTGGTGGTGACCC TATTTTATATCAACA