Hemerobiidae is the third largest family of the order Neuroptera, containing c.a. 600 species worldwide (Oswald, 2004; Farahi et al., 2009). They are similar to the species of Chrysopidae in general structure, but differ in several aspects. Commonly, hemerobiids are brownish in color, while chrysopids are green. They are also much less common than the latter in number of specimens (Banks, 1905). In forewing, a forked recurrent humeral vein is found in hemerobiids except Micromus spp., but not in chrysopids. Their forewing characters can distinguish them from other neuropteran families by the combination of (1) anterior radial trace with two or more radial sectors and (2) absence of nygmata (Oswald, 1993).

Eighteen species of Hemerobiidae have been recorded in Korea Peninsula, and most of them were listed from North Korea (Monserrat, 2000). So far, eight species have been described in South Korea (ESK and KSAE, 1994; Paek et al., 2010).

Drepanepteryginae (낙엽날개뱀잠자리붙이아과, new Korean name) are large hemerobiids, and are distributed in Asia, Europe, and Southern South America. Proposed synapomorphies for the subfamily include (1) temporal costae lost or poorly developed, (2) forewing intramedial crossvein 2im present, and (3) forewing intercubital crossvein 1cua-cup present (Oswald, 1993).

Only one species, Neuronema albostigma, has been reported in Korea, and here we report Drepanepteryx phalaenoides, the second species in Drepanepteryginae of Korea. This species is rather a well-known species in the Palaearctic region, but it is the first time that the occurrence of the genus and the species is reported as new to Korea.

Materials and Methods

We examined our collected specimens as well as some dried specimens loaned from the Korea National Arboretum (KNA). The samples were examined through a dissecting microscope with an imaging apparatus. The forewing length was measured from the base to the apex. For some samples, their genitalia were dissected, examined, and saved in glycerol. We also extracted its nucleic acids to get a sequence of COI barcode region following the method described in An et al. (2014). The specimens examined were deposited at the insect collection room of the Department of Plant Medicine in Chungbuk National University.

Taxonomic Account

Genus DrepanepteryxLeach, 1815

DrepanepteryxLeach, 1815:138.

Type: Hemerobius phalaenoides Linné, 1758:550.

Drepanopteryx [sic]: Burmeister, 1839:975.

DrepanopteryxAgassiz, [1847] 1842-1846:130 (unjustified emendation).

MegalomusRambur, 1842:418.

CanisiusNavás, 1913:512.

OedobiusNakahara, 1915:44.

PhlebonemaKruger, 1922:170.

BestretaNavas, 1924:222.

Diagnosis

Body size: middle to large. Forewing: crossvein 2sc-r present; anterior radial trace bearing eight or more radial sectors; costal space with gradate series of five or more crossveins.

Drepanepteryx phalaenoides (Linné 1758) 낙엽날개뱀잠자 리붙이(신칭) (Figs. 1, 2a-c, and 3a)

Hemerobius phalaenoidesLinné 1758:550.

Drepanopteryx phalaenoides, Burmeister, 1839:975; Wesmael, 1841:219; Rostock, 1888:108; Kuwayama, 1962:358.

Drepanepteryx phalaenoides, Leach, 1815:138; Wallengren, 1871:33; Kuwayama, 1920:87, pl. 1, figs. 1, 4-7; Krüger, 1922: 179; Matsumura, 1931:1161, fig.; Matsumura, 1933:8 (12), pl. 2, fig. 16; Killington, 1937:143, pl. 17, fig. 2, text figs. 98, 99.

Megalomus phalaenoides, Rambur, 1842:418. Pl. 9, fig. 6.

Diagnosis

Adult (Figs. 1 and 3a). Head: antennal flagellum 55-56 segmented. Thorax: browish; prothorax blackish laterally; mesothorax longer than prothorax and metathorax. Wing: forewing length 13-16 mm; forewing (Fig. 1) light brown, brown along veins, with brown mesh-like pattern, distinctly falcate at apex, with a small blackish brown spot near basal 2/5 of M1; 2sc-r present; with two dark brown lines, inner one along third intraradial and intramedial crossveins and outer one along fourth intraradial and intramedial crossveins, outer line usually narrower or fainter than inner line; with a dark brown line from near anterior 2/5 point of inner line to apex, line somewhat darker towards apex.

Male genitalia (Fig. 2). Ectoproct and anal plate sclerotized with setae (Fig. 2a); callus cerci rounded (Fig. 2c); gonarcus curved downward, beak-shaped (Fig. 2b); parabaculum elongated, clamp shaped, distally curved outwardly and downwardly, with pointed tip.

Material Examined

1 female, 1 male. Jangsan, Sangdong-eup, Yeongwol-gun, GW. May 18, 2010. S.Y. Park, J.S. Lim, B.K. Byun; 1 female. Jangsan, Sangdong-eup, Yeongwol-gun, GW. Jun. 14, 2010. S.Y. Park, J.S. Lim, B.K. Byun; 1 female. Bannonsan, Yeoryangmyeon, Jeongseon, GW. May 19, 2010. S.Y. Park, J.S. Lim, B.K. Byun; 1 female. Bannonsan, Yeoryang-myeon, Jeongseon, GW. Jul. 20, 2010. S.Y. Park, J.S. Lim, K.M. Kim; 1 male. Obong-ri, Geumseo-myeon, Sancheong-gun, GN. Jun. 4, 2013. S.K. Lee, S.K. Kim; 1 female. 34, Sambonghyuyangrim-gil, Nae-myeon, hongcheon-gun, GW. Jun. 6, 2015. S.K. Kim; 1 female. Yongmun, Daegwang-ri, Juam-myeon, Suncheon-si, JN. Jul. 15, 2015. G.H. Cho.

Distribution

The species is widely distributed in the Palearctic region including Russia, China, Japan and Korea.

Remarks

This species is known as a beneficial predator of plant-sucking insect pests. The species is widely distributed, but never reaching significant abundance, on different deciduous trees and shrubs (Stelzl and Devetak, 1999).

Key to the species of Korean Drepanepteryginae

COI barcode sequence

TTGATCAGGTCTTGTAGGAACAAGACTTAGATTATTAA TTCGAGCAGAATTAGGTCAACCAGGTTCATTAATTGGTGA TGATCAAGTTTATAATGTTATTGTTACTGCTCATGCATTTA TTATAATTTTTTTTATAGTTATACCAATTGTTATTGGTGGA TTTGGAAACTGATTAGTCCCATTAATATTAGCTGCACCGG ATATAGCATTCCCTCGAATAAATAATATAAGATTCTGAAT ACTACCTCCCTCTTTAACACTTTTATTAGCTTCATCAATGG TGGAAAGTGGGGCTGGTACAGGTTGAACTGTATACCCACC CCTCTCATCAAGTATTGCTCATGCAGGAGCATCAGTTGAT TTAGCAATTTTTAGCCTACATTTAGCTGGAGTCTCAAGAA TTTTAGGAGCAGTAAATTTTATTACTACAGTTATTAATATG CGTTTAAATTATATAACTTTAGATCGTATACCATTATTTGT TTGATCAGTAGTAATTACTGCCTTACTTCTATTATTATCAT TACCCGTATTAGCTGGAGCTATCACTATATTATTAACAGA CCGAAATCTAAACACATCATTCTTTGACCCTGCAGGGGGA GGGGACCCAATTTTATATCAACATTTATTTTGATTTTT