The fairyfly wasp Anagrus (Anagrus) arboridiaeTriapitsyn and Adachi-Hagimori, 2020 (Hymenoptera: Mymaridae) is a recently described egg parasitoid of the Japanese grape leafhopper Arboridia (Arboridia) apicalis (Nawa, 1913) (Hemiptera: Cicadellidae) (Triapitsyn et al., 2020). It was previously known only from Honshu and Kyushu islands in Japan (Triapitsyn et al., 2020). Whereas in Japan only two species of the genus Arboridia Zachvatkin, 1946, A. apicalis and A. (Arboridia) suzukii (Matsumura, 1916), had been reported as grapevine pests (Sakagami, 2003;Yamada, 2003), only the former was found during the recent surveys in the organic vineyards in Miyazaki and Shimane prefectures (Triapitsyn et al., 2020).

In South Korea, several species of Arboridia (Arboridia) were reported from grapevines, as follows. Arboridia kakogawana (Matsumura, 1932) and A. maculifrons (Vilbaste, 1968) were studied in Chungcheongbuk-do (Ahn et al., 2005), although more recently their status as grapevine pests has diminished significantly with cultivation of hybrid grape varieties being predominant (Ki-Su Ahn, personal communication). Indeed, Lee et al. (2014) reported these two species, along with an Arboridia sp. (as A. “nigrigena”), as at most minor pests of table grapes for both domestic and export consumption occurring in very low numbers in Chungcheongbuk-do and Gyeongsangbuk- do. Actually, A. “nigrigena” has never been validly described, so this scientific name is unavailable despite also being included in the key to the Arboridia species in the Korean Peninsula along with A. apicalis and A. suzukii (Oh et al., 2015b). However, A. “nigrigena” was not included in the updated key to the Arboridia species in the Korean Peninsula by Oh et al. (2015a), who also described A. septempunctata Choe and Jung from Suwon in Gyeonggi-do and indicated its host plant as a Vitis sp. There is also an unresolved problem with apparent misidentifications of A. “kakogawana” in the Korean Peninsula and elsewhere: Triapitsyn et al. (2020) indicated that although this leafhopper species is native to Japan, it has never been collected there on cultivated grapes. According to Triapitsyn et al. (2020), the holotype female of A. kakogawana, collected (without indication of a host plant association) in Kakogawa (near Akashi), Hyogo Prefecture, Honshu Island (Matsumura, 1932), might not be conspecific with the males from Korea, on whose genitalic characters the current recognition of this species is based upon (Dworakowska, 1970). Therefore, the undetermined (and likely undescribed) leafhopper species that was previously reported from the Korean Peninsula as A. “kakogawana” is called here as Arboridia sp. Its true taxonomic identity as an undescribed species will be revealed elsewhere (N. Ohara, in preparation).

Figuring out the proper identity of A. “kakogawana” is very important as it is an invasive pest of cultivated grapevines in Xinjiang Uyghur Autonomous Region in northwestern China, southwestern Russia, Ukraine, Moldova, Romania, Bulgaria, Hungary, Serbia (Cao et al., 2017;Chireceanu et al., 2020;Šćiban et al., 2021;Tomov, 2021;Gargalik, 2022;Schlitt et al., 2024) and, most recently, Italy (De Luigi et al., 2025). As such this species was categorized as being a potential Union quarantine pest in the European Union (EFSA Panel on Plant Health, 2022). It was also reported, besides the Korean Peninsula, from several other provinces of mainland China (Han et al., 2024) and the Russian Far East where it is apparently native. In Turpan, Xinjiang Uyghur Autonomous Region in northwestern China, its known egg parasitoid is Anagrus (Anagrus) turpanicus Triapitsyn and Hu, 2016 (Hu and Triapitsyn, 2016). Meanwhile, A. apicalis was reported as a grapevine pest in Yinchuan, Ningxia Hui Autonomous Region in China (Lou, 2024).

The purpose of this study was to collect fresh specimens of grape leafhoppers in central provinces of the Republic of Korea (Chungcheongbuk-do and Gyeongsangbuk-do) for both morphological and molecular identification (results of the molecular study to be reported elsewhere), but primarily to rear and identify egg parasitoids of these grape leafhoppers because that has never been done before in the country.

Materials and Methods

Collecting of specimens

Both conventional (many), a few abandoned, and two organic vineyards growing table grapes in Chungcheongbuk-do (Fig. 1a) and Gyeongsangbuk-do were surveyed during three consecutive days in August 2024. Leafhoppers were collected by sweeping from grape leaves lightly to moderately (Fig. 1b) damaged by their feeding. Voucher specimens of the leafhoppers and their egg parasitoids were deposited in the insect collections of Entomological Laboratory, Faculty of Agriculture, Kyushu University, Fukuoka, Japan (ELKU) and the Entomology Research Museum, University of California, Riverside, California, USA (UCRC). The leafhoppers were preserved in 80% ethanol, sorted to morphospecies by S. V. Triapitsyn, and further identified by N. Ohara based on male genitalic characters and using the available keys (Oh et al., 2015a;Han et al., 2024), and also by comparing with the original descriptions and subsequent redescriptions of the identified taxa. Egg parasitoids were both collected by sweeping and by rearing from grape leaves using the same method as described in Triapitsyn et al. (2020) and preserved in 95% ethanol for further study and morphological identification by S. V. Triapitsyn, followed by slide-mounting of selected specimens in Canada balsam.

Morphological identification of the egg parasitoid

The keys in Triapitsyn (2015) and Triapitsyn et al. (2020) were used for parasitoid identifications along with direct comparison with the original description and illustrations of the identified species.

Molecular identification of the egg parasitoid

Molecular analyses for egg parasitoids were conducted at the Department of Entomology, Kyungpook National University, Sangju-si, South Korea. Genomic DNA was extracted using the Qiagen DNeasy Blood & Tissue Kits (Qiagen, Hilden, Germany) as the process described in the kit instructions. The whole body of each individual was used for DNA extraction. The standard “barcoding” region of the mitochondrial cytochrome c oxidase subunit I gene (COI) was amplified using the primer set LepF1 (5' - ATTCAACCAATCATAAAGATATTGG - 3') and LepR1 (5'- TAAACTTCTGGATGTCCAAAAAATC- 3') (Hebert et al., 2004). PCR amplification was performed in a total volume of 25 μL, consisting of 12.5 μL of DreamTaq PCR Master Mixes (2X) (Thermo Fisher Scientific, Waltham, Massachusetts, USA), 1 μL of each primer at a concentration of 10 μM, 2.5 μL of DNA template, and 8 μL of double-distilled H₂O. The PCR began with an initial denaturation at 94°C for 3 minutes, followed by 4 cycles of denaturation at 94°C for 30 seconds, annealing at 45°C for 40 seconds, and extension at 72°C for 1 minute. The subsequent 34 cycles were conducted under the same denaturation and extension conditions, but the annealing temperature was increased to 50°C. The final extension was performed at 72°C for 7 minutes. Genomic DNA was sequenced at the Macrogen Inc. (Sejong-si, South Korea) by Sanger sequencing. The obtained sequences were edited and assembled using Geneious Prime version 2025.0.1 (https://www.geneious. com). Genetic distances between sequences were estimated using MEGA 11 (Tamura et al., 2021) under the Kimura twoparameter model (K2P) (Kimura, 1980), with pairwise deletion for the missing or gap data.

Results

Egg parasitoid of Arboridia (Arboridia) spp. in South Korea

Anagrus (Anagrus) arboridiae Triapitsyn and Adachi- Hagimori, 2020 (Fig. 2) 포도신총채벌

Anagrus (Anagrus) arboridiae Triapitsyn and Adachi-Hagimori in Triapitsyn et al. 2020: 135–141. Type locality: Oku- Izumo Vineyard, 35°17'20"N, 132°55'46"E, 155 m, Unnan, Shimane Prefecture, Honshu Island, Japan. Holotype female [ELKU], examined.

Material examined. Republic of Korea, Chungcheongbukdo, Okcheon-gun, near Okcheon-eup, Samcheong-ri, 36°16' 08"N 127°34'36"E, 134 m, Eco Vineyard, 23.viii.2024, S.V. Triapitsyn, I. Kang, S. Kim, J. Kim: sweeping organic table grapes of mixed varieties [4 females (Fig. 2a), 1 male (Fig. 2b), UCRC]; emerged 24.viii–20.ix.2024 from grape leaves, S. Kim [13 females, 12 males, UCRC].

Distribution. Japan (Triapitsyn et al., 2020), and South Korea [new record].

Hosts. Hemiptera: Cicadellidae: Arboridia apicalis in Japan (Triapitsyn et al., 2020) and apparently two other Arboridia spp. in the Republic of Korea [new records], A. maculifrons and Arboridia sp. (= A. “kakogawana”).

Molecular identification of the egg parasitoid

Genetic analysis revealed a sequence match, indicating that the Korean A. arboridiae specimens belong to the same species as the Japanese specimens previously recorded. The genetic distance between the Korean specimen (PV668810) and the Japanese specimen (MT396448, from Triapitsyn et al., 2020) showed minimal divergence of 0.5% difference. This low divergence between the Korean and Japanese specimens substantiates their conspecificity as the delimitation of Molecular Operational Taxonomic Units (MOTU) is often based on a 2% COI divergence threshold (Jones et al., 2011). In contrast, the genetic distances between A. arboridiae and A. (Anagrus) japonicus Sahad (MT396446, MT396447) ranged from 4.9 to 5.4 %, strongly supporting species-level delimitation. These results demonstrate COI barcoding can be an effective tool for distinguishing the minute fairyfly species and reinforces the identification of A. arboridiae as a newly recorded taxon in South Korea (Table 1).

Morphological identification of the egg parasitoid

In having mosly light females (Fig. 2a) and slightly darker males (Fig. 2b), the aforementioned specimens are identical to those of Anagrus (Anagrus) arboridiae from Japan which were reared there from eggs of Arboridia apicalis (Triapitsyn et al., 2020). Like in the type series of A. (Anagrus) arboridiae from Japan (Triapitsyn et al., 2020), female specimens from South Korea have the body pale yellow except for the mesoscutum being mostly light brown and the two basal gastral terga being contrastingly brown; the antenna with multi-porous plate sensilla on the third (0 or 1), fourth (1 or 2), fifth (1), sixth (2) funicular segments and the clava (3); the midlobe of mesoscutum without adnotaular setae; fore wing disc with a distinct subapical bare area; and the ovipositor 1.9–2.1 times length of protibia.

Discussion

Viticulture is an economically important agricultural industry worldwide with approximately 7.2 million hectares of cultivated areas (FAO, 2025), and South Korea shows steady expansion of commercial vineyards (KREI, 2024). Some members of Arboridia spp. can be economically important pests that damage foliage, reducing grape productivity in South Korea (Ahn et al., 2005;Lee et al., 2014). Furthermore, A. “kakogawana” were designated as a potential quarantine pest in the European Union (EFSA Panel on Plant Health, 2022). Given the economic importance of grapes, managing Arboridia spp. populations is important for sustaining grape yields and quality.

No leafhoppers were found in any conventional (with at least some pesticide use) vineyards in the central South Korea. In a small organic vineyard in Gyeongsangbuk-do (near Gimcheon- si, Taehwa-ri, 36°09'15"N 128°01'23"E, 120 m, 21.viii. 2024, S. V. Triapitsyn, I. Kang), only one leafhopper male was collected from grape leaves, which was identified as Eurhadina (Eurhadina) japonica Dworakowska, 1971. This species was previously known only from mainland China and Japan and is for the first time recorded herein from Korea. No egg parasitoids were reared from grape leaves from that site, seemingly due to a very low density of this leafhopper host.

In the organic Eco Vineyard (36°16'08"N 127°34'36"E, 134 m, Samcheong-ri, Okcheon-gun, Chungcheongbuk-do, Fig. 1a), two species of Arboridia (Arboridia) were collected: A. maculifrons (Fig. 1d) was predominant, while Arboridia sp. [= A. “kakogawana” of Lee et al. (2014)] (Figs. 1c, 1e) was present in smaller numbers. We also determined that A. septempunctata is actually the same species as A. “nigrigena” of Oh et al. (2015b) and Lee et al. (2014), but it was not present in our samples. Egg parasitoids swept and reared from grape leaves from the same vineyard were identified, both morphologically and molecularly, as Anagrus arboridiae. Both sexes of the Korean specimens are morphologically identical to those from Japan, as described and illustrated in Triapitsyn et al. (2020), providing a taxonomic basis for the species-level identification of potential natural enemies of grape leafhoppers and for future evaluation of their biological control potential.

Government office of the South Korean Ministry of Agriculture, Food and Rural Affairs (MAFRA) implements the Postivie List System (PLS) since 2019, the regulation permitting the use of only registered pesticides with established maximum residue limits (MRL), while uniformly restricting all unregistered chemicals to a tolerance limit (Lee et al., 2017; MFDS, 2017). Therefore, implementation of this regulation has emphasized the growing necessity of biological control as an alternative to chemical pesticides. The discovery of A. arboridiae in South Korea can be important for its organic and eco-friendly viticulture. Moreover, given the quarantine status of the leafhopper pest in the invaded European countries, A. arboridiae from South Korea can be considered as a potential classical biological control agent against the Arboridia sp. grapevine pest in its non-native range.